Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ido1
- Ensembl ID:
- ENSDARG00000033594
- ZFIN ID:
- ZDB-GENE-080228-2
- Description:
- indoleamine 2,3-dioxygenase 2 [Source:RefSeq peptide;Acc:NP_001077323]
- Human Orthologue:
- IDO2
- Human Description:
- indoleamine 2,3-dioxygenase 2 [Source:HGNC Symbol;Acc:27269]
- Mouse Orthologue:
- Ido2
- Mouse Description:
- indoleamine 2,3-dioxygenase 2 Gene [Source:MGI Symbol;Acc:MGI:2142489]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa12360 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12360
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000056361 | Nonsense | 222 | 435 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 8 (position 52328278)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 50478286 GRCz11 8 50466932 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGARATAATCACAGGAGGACTTCAAAAGTHTGTCTTACTCTTTCAGAATA[T/A]GTAGATCCCTCCATATTCTACGGCGTTATAAGGATCTTTCTTTCTGGGTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
