zgc:73254

Ensembl ID:
ENSDARG00000033586
ZFIN ID:
ZDB-GENE-040426-1732
Description:
Pyridine nucleotide-disulfide oxidoreductase domain-containing protein 1 [Source:UniProtKB/Swiss-Pro
Human Orthologue:
PYROXD1
Human Description:
pyridine nucleotide-disulphide oxidoreductase domain 1 [Source:HGNC Symbol;Acc:26162]
Mouse Orthologue:
Pyroxd1
Mouse Description:
pyridine nucleotide-disulphide oxidoreductase domain 1 Gene [Source:MGI Symbol;Acc:MGI:2676395]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7011 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042663 Nonsense 272 489 9 13
Genomic Location (Zv9):
Chromosome 5 (position 62717498)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70505080
GRCz11 4 72024474
KASP Assay ID:
554-4832.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAATACGAGTGTGAGGTTGAGCAGATTTACACCCAGCAGGARCTTCTG[C/T]AGTCCGARCACRGCACAAAGACRGCTGAATTAGGTAAATTMACAAACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link