
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
efr3ba
- Ensembl ID:
- ENSDARG00000033516
- ZFIN ID:
- ZDB-GENE-030616-64
- Description:
- Novel protein similar to KIAA0953 [Source:UniProtKB/TrEMBL;Acc:Q7ZZB2]
- Human Orthologue:
- EFR3B
- Human Description:
- EFR3 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:29155]
- Mouse Orthologue:
- Efr3b
- Mouse Description:
- EFR3 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2444851]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16223 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16223
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040346 | Nonsense | 605 | 821 | 16 | 23 |
ENSDART00000135118 | Nonsense | 363 | 578 | 9 | 16 |
The following transcripts of ENSDARG00000033516 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 17 (position 33448976)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 33290707 GRCz11 17 33243218 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACACTTCCTGTTTATTCCCGCTGTGCCATCCATGCTCTGTCTGCTGCATA[T/A]CTCAACCTCATCAGCCAACTGACCACTGTGCCCACCTTCTGCCAACACGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: