zgc:136354

Ensembl ID:
ENSDARG00000033444
ZFIN ID:
ZDB-GENE-060512-339
Description:
mitogen-activated protein kinase kinase kinase kinase 2 [Source:RefSeq peptide;Acc:NP_001038725]
Human Orthologue:
MAP4K2
Human Description:
mitogen-activated protein kinase kinase kinase kinase 2 [Source:HGNC Symbol;Acc:6864]
Mouse Orthologue:
Map4k2
Mouse Description:
mitogen-activated protein kinase kinase kinase kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1346883]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19265 Nonsense Mutation detected in F1 DNA During 2018
sa9330 Nonsense Mutation detected in F1 DNA During 2018
sa45743 Nonsense Mutation detected in F1 DNA During 2018
sa16426 Essential Splice Site Available for shipment Available now
sa16484 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Nonsense 97 889 4 32
ENSDART00000100351 Nonsense 97 889 4 32
Genomic Location (Zv9):
Chromosome 21 (position 33005649)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34005342
GRCz11 21 34039832
KASP Assay ID:
2261-5856.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAAATAACAAGTTATGGATCTGCATGGAATTCTGTGGAGGAGGGTCAT[T/A]GCAAGATATTTACCATGGTATAGAATTCAGCAATTTGCTTAATTTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Nonsense 97 889 4 32
ENSDART00000100351 Nonsense 97 889 4 32
Genomic Location (Zv9):
Chromosome 21 (position 33005649)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34005342
GRCz11 21 34039832
KASP Assay ID:
2261-5856.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAAATAACAAGTTATGGATCTGCATGGAATTCTGTGGAGGAGGGTCAT[T/A]GCAAGATATTTACCATGGTATAGAATTCAGCAATTTGCTTAATTTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Nonsense 399 889 18 32
Genomic Location (Zv9):
Chromosome 21 (position 33023304)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34022997
GRCz11 21 34057487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGTGTCCGTAATATCAACAGCACTCACCAAATGAAGAGGATAAATA[T/A]GGGACTGTGAAGAGGATGGCCTCTTCTCCCCAATCAACAGCCCTCTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Essential Splice Site 524 889 20 32
ENSDART00000100351 Essential Splice Site 524 889 20 32
Genomic Location (Zv9):
Chromosome 21 (position 33024883)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34024576
GRCz11 21 34059066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCATTACCAAACTTTAATCAGTCTCTCRCAATTTATTACTTATAAAA[G/T]AAAGCTGTTGTCMATGGACTGCCACCTAMACCACAAGTACATGTAAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Essential Splice Site 524 889 20 32
ENSDART00000100351 Essential Splice Site 524 889 20 32
Genomic Location (Zv9):
Chromosome 21 (position 33024883)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34024576
GRCz11 21 34059066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCATTACCAAACTTTAATCAGTCTCTCRCAATTTATTACTTATAAAA[G/T]AAAGCTGTTGTCMATGGACTGCCACCTAMACCACAAGTACATGTAAGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association study for serum urate concentrations and gout among African Americans identifies genomic risk loci and a novel URAT1 loss-of-function allele. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link