
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
twsg1a
- Ensembl ID:
- ENSDARG00000033428
- ZFIN ID:
- ZDB-GENE-010509-2
- Description:
- Twisted gastrulation protein homolog 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q9DGH0]
- Human Orthologue:
- TWSG1
- Human Description:
- twisted gastrulation homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:12429]
- Mouse Orthologue:
- Twsg1
- Mouse Description:
- twisted gastrulation homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2137520]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33059 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33059
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049963 | Essential Splice Site | 76 | 217 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 2 (position 55441708)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 55086257 GRCz11 2 54819186 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTATGTTGTGTTTAAGTGCTCTCTGGGAGGAGTGCTGCGACTGTGTGGG[T/C]GAGTCTCAAATCAAACAAATCTCAACACTAATCTCGTATTTAACTATGAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Dental caries: GWAS of dental caries patterns in the permanent dentition. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: