twsg1a

Ensembl ID:
ENSDARG00000033428
ZFIN ID:
ZDB-GENE-010509-2
Description:
Twisted gastrulation protein homolog 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q9DGH0]
Human Orthologue:
TWSG1
Human Description:
twisted gastrulation homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:12429]
Mouse Orthologue:
Twsg1
Mouse Description:
twisted gastrulation homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2137520]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33059 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049963 Essential Splice Site 76 217 3 5
Genomic Location (Zv9):
Chromosome 2 (position 55441708)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55086257
GRCz11 2 54819186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATGTTGTGTTTAAGTGCTCTCTGGGAGGAGTGCTGCGACTGTGTGGG[T/C]GAGTCTCAAATCAAACAAATCTCAACACTAATCTCGTATTTAACTATGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link