Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gyg2
- Ensembl ID:
- ENSDARG00000033380
- ZFIN ID:
- ZDB-GENE-080723-74
- Description:
- glycogenin 2 [Source:RefSeq peptide;Acc:NP_001139048]
- Human Orthologues:
- GYG1, GYG2, GYG2P1
- Human Descriptions:
- glycogenin 1 [Source:HGNC Symbol;Acc:4699]
- glycogenin 2 pseudogene 1 [Source:HGNC Symbol;Acc:4701]
- glycogenin 2 [Source:HGNC Symbol;Acc:4700]
- Mouse Orthologue:
- Gyg
- Mouse Description:
- glycogenin Gene [Source:MGI Symbol;Acc:MGI:1351614]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa32706 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa32706
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000041191 | Nonsense | 217 | 409 | 6 | 9 |
- Genomic Location (Zv9):
- Chromosome 1 (position 33009839)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 32612019 GRCz11 1 33344587 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCATTTGCACAGGTATGGCCACCATGCAAAAATTGTCCATTTCTTGGGA[G/T]GAACCAAACCCTGGCATCTTCCATATGATCCACAGGCTGCCAATGAATCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
