si:dkeyp-9c8.1

Ensembl ID:
ENSDARG00000033345
ZFIN ID:
ZDB-GENE-090313-409
Description:
Novel protein similar to H.sapiens CNTLN, centlein, centrosomal protein (CNTLN) [Source:UniProtKB/Tr
Human Orthologue:
CNTLN
Human Description:
centlein, centrosomal protein [Source:HGNC Symbol;Acc:23432]
Mouse Orthologue:
Cntln
Mouse Description:
centlein, centrosomal protein Gene [Source:MGI Symbol;Acc:MGI:2443104]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16056 Nonsense Available for shipment Available now
sa32688 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39622 Nonsense Mutation detected in F1 DNA During 2018
sa24847 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39621 Nonsense Mutation detected in F1 DNA During 2018
sa30583 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16056
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044234 Nonsense 74 1120 3 25
ENSDART00000147414 Nonsense 100 428 4 11

The following transcripts of ENSDARG00000033345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25973789)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26314006
GRCz11 1 27007720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGAAGCAGAAGGCWGAGAACAAGGACAGAAAAGTTCTGGAGATCCTT[C/T]AAGCAAAAGACTACAGGATCCAAGAGCTGGAGCAGGTACTGTGAGAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044234 Essential Splice Site 130 1120 4 25
ENSDART00000147414 Essential Splice Site 156 428 5 11

The following transcripts of ENSDARG00000033345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25966761)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26306978
GRCz11 1 27000692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGGCAGCTCTGCAGCACAGACTGGGGAATAAGAGTCGACAACTTAAG[G/A]TTTGGACAAATTTCCACTGGCACCACTTTTAAAGCGCTGCCTCTGCGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044234 Nonsense 212 1120 6 25
ENSDART00000147414 Nonsense 238 428 7 11

The following transcripts of ENSDARG00000033345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25960334)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26300551
GRCz11 1 26994265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTCAGAGCCGCTCAACTGCTTTGTCCCTTCAGCTATCCTCAGTAGAA[C/T]GAGAAAGAGCTGACAACGAACAACAACTCTGTCAAATCAAGTAAGTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044234 Essential Splice Site 465 1120 12 25
ENSDART00000147414   None 428 None 11

The following transcripts of ENSDARG00000033345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25857692)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26197909
GRCz11 1 26891623
KASP Assay ID:
554-7454.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATTGCAGCACAGGAGATCCAAGAGGATCGGCGGGAGGCAGCGCAAG[G/A]TAACACTGACATCACTCACTGTCCTACCTCACGCACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044234 Nonsense 712 1120 17 25
ENSDART00000147414   None 428 None 11

The following transcripts of ENSDARG00000033345 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25836125)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26176342
GRCz11 1 26870056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGCAGAAGATGAGGAGGAGAAAAACATCAAAGCCCCATTCTGCTTTA[C/T]GACAGCATCTTCTGTCCCTCCAGCAGCAAGTGGCAGCACTACAGGCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044234 Nonsense 927 1120 21 25
ENSDART00000147414   None 428 None 11

The following transcripts of ENSDARG00000033345 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25810075)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26150292
GRCz11 1 26844006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTCTCAAGAGAAGATTGACAGTTGCCACTGCAGAAAAAACTCAGCAG[G/T]AGACAAGCAGCCGCAAACTCAAAGAGGAGCTTCAGAAAAAGGTGCAAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian cancer: A genome-wide association study identifies a new ovarian cancer susceptibility locus on 9p22.2. (View Study)
  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link