si:dkey-3n7.1

Ensembl ID:
ENSDARG00000033296
ZFIN ID:
ZDB-GENE-041210-264
Description:
hypothetical protein LOC568430 [Source:RefSeq peptide;Acc:NP_001137521]
Human Orthologue:
GPR37
Human Description:
G protein-coupled receptor 37 (endothelin receptor type B-like) [Source:HGNC Symbol;Acc:4494]
Mouse Orthologue:
Gpr37
Mouse Description:
G protein-coupled receptor 37 Gene [Source:MGI Symbol;Acc:MGI:1313297]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9900 Nonsense Available for shipment Available now
sa14339 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049194 Nonsense 269 611 1 2
Genomic Location (Zv9):
Chromosome 4 (position 3853572)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3972185
GRCz11 4 3981098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATACGGGGCGTATGCAATCACCATCATCYCCGTGCTTATTTTTGCGGTG[G/T]GAATAACCGGGAACATAGCAATAATGTGTGTTGWGTGCCAKAACTACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049194 Nonsense 441 611 2 2
Genomic Location (Zv9):
Chromosome 4 (position 3870451)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3989064
GRCz11 4 3997977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTCTACGTGTTGGGTTTGACCTATGAAGGTGCTCGATTGTGGYGGTG[T/A]TTYGGCTGCTATTTCWGCCTGCCCACGCTCTTCACTATYGGGAGCTCGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link