zgc:123274

Ensembl ID:
ENSDARG00000033273
ZFIN ID:
ZDB-GENE-051113-100
Description:
Coiled-coil domain-containing protein 111 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q32PL8]
Human Orthologue:
CCDC111
Human Description:
coiled-coil domain containing 111 [Source:HGNC Symbol;Acc:26575]
Mouse Orthologue:
Ccdc111
Mouse Description:
coiled-coil domain containing 111 Gene [Source:MGI Symbol;Acc:MGI:3603756]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1189 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006147 Splice Site, Nonsense 61 523 2 14
ENSDART00000146638 Splice Site, Nonsense 61 150 1 5
ENSDART00000147076 Splice Site, Nonsense 61 205 2 6
Genomic Location (Zv9):
Chromosome 1 (position 20347438)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20871849
GRCz11 1 21564786
KASP Assay ID:
554-1098.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCTTCCCACGCCAGAATGCAGCCATTGCCTTTGCTCAGCACATTAAA[C/T]AGGTCTAGAGAAAAGCCGTTGGATATTTGTGATGTACCNGTGAAGCAGTAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link