
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:101840
- Ensembl ID:
- ENSDARG00000033201
- ZFIN ID:
- ZDB-GENE-041010-43
- Description:
- hypothetical protein LOC449795 [Source:RefSeq peptide;Acc:NP_001005968]
- Human Orthologue:
- CRIP3
- Human Description:
- cysteine-rich protein 3 [Source:HGNC Symbol;Acc:17751]
- Mouse Orthologue:
- Crip3
- Mouse Description:
- cysteine-rich protein 3 Gene [Source:MGI Symbol;Acc:MGI:2152434]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18230 | Essential Splice Site | Available for shipment | Available now |
sa32276 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18230
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040557 | Essential Splice Site | 15 | 202 | 1 | 8 |
ENSDART00000133000 | None | 113 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 9640292)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 9474561 GRCz11 20 9462300 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGAACATGGCAWCAAAATGTCCCAAATGTGAAAAAACWGTTTATTTTGG[T/G]AAGTCATTCATTTTTCCCCTTTCTTTTCGCWGTAYCAATAACACAATGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32276
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040557 | Nonsense | 75 | 202 | 4 | 8 |
ENSDART00000133000 | None | 113 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 9614334)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 9448603 GRCz11 20 9436342 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACTGTGTTGTGTTGTGTGTAGGTGTAAATATCGGAGGGGCTGGATCATA[T/G]GTCTATGATACACCTGTTGGCGATGACTCTGTTCCTGTTGCCATGGAAAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: