zgc:85676

Ensembl ID:
ENSDARG00000033179
ZFIN ID:
ZDB-GENE-040426-2205
Description:
chromosome 7 open reading frame 23 [Source:RefSeq peptide;Acc:NP_998084]
Human Orthologue:
C7orf23
Human Description:
chromosome 7 open reading frame 23 [Source:HGNC Symbol;Acc:21707]
Mouse Orthologue:
4930420K17Rik
Mouse Description:
RIKEN cDNA 4930420K17 gene Gene [Source:MGI Symbol;Acc:MGI:3606159]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26224 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041289 Essential Splice Site 79 125 6 6

The following transcripts of ENSDARG00000033179 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 8681081)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9617929
GRCz11 4 9618845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACCAAAATTAAAATCAATGCAAGTAAATGCAATCTCTCTCATTCTTTC[A/T]GATATACTGGTATAGGCAGGGAGATCTGGAGCCTAAGTTCCGCAACTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link