
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:85676
- Ensembl ID:
- ENSDARG00000033179
- ZFIN ID:
- ZDB-GENE-040426-2205
- Description:
- chromosome 7 open reading frame 23 [Source:RefSeq peptide;Acc:NP_998084]
- Human Orthologue:
- C7orf23
- Human Description:
- chromosome 7 open reading frame 23 [Source:HGNC Symbol;Acc:21707]
- Mouse Orthologue:
- 4930420K17Rik
- Mouse Description:
- RIKEN cDNA 4930420K17 gene Gene [Source:MGI Symbol;Acc:MGI:3606159]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa26224 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa26224
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041289 | Essential Splice Site | 79 | 125 | 6 | 6 |
The following transcripts of ENSDARG00000033179 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 4 (position 8681081)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 9617929 GRCz11 4 9618845 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTACCAAAATTAAAATCAATGCAAGTAAATGCAATCTCTCTCATTCTTTC[A/T]GATATACTGGTATAGGCAGGGAGATCTGGAGCCTAAGTTCCGCAACTTGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder and major depressive disorder (combined): Meta-analysis of genome-wide association data of bipolar disorder and major depressive disorder. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: