
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
trappc6bl
- Ensembl ID:
- ENSDARG00000033171
- ZFIN ID:
- ZDB-GENE-040426-1602
- Description:
- trafficking protein particle complex 6b-like [Source:RefSeq peptide;Acc:NP_956955]
- Human Orthologue:
- TRAPPC6A
- Human Description:
- trafficking protein particle complex 6A [Source:HGNC Symbol;Acc:23069]
- Mouse Orthologue:
- Trappc6a
- Mouse Description:
- trafficking protein particle complex 6A Gene [Source:MGI Symbol;Acc:MGI:1914341]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18603 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18603
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043492 | Nonsense | 83 | 161 | 4 | 7 |
ENSDART00000133080 | Nonsense | 83 | 102 | 4 | 5 |
ENSDART00000147796 | None | 77 | None | 3 |
The following transcripts of ENSDARG00000033171 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 15 (position 14113939)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 14144987 GRCz11 15 14080944 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACATAATGAAGTTCGTATGTAAAGACTTCTGGAGCACTMTCTTCAAAAAA[C/T]AAATCGACAACTTGAGGACCAACCATCAGGTCTCAATGTTCAGTACTATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: