zgc:92824

Ensembl ID:
ENSDARG00000033143
ZFIN ID:
ZDB-GENE-040718-214
Description:
Transcription elongation factor SPT4 [Source:UniProtKB/Swiss-Prot;Acc:Q6DGQ0]
Human Orthologue:
SUPT4H1
Human Description:
suppressor of Ty 4 homolog 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:11467]
Mouse Orthologue:
Supt4h1
Mouse Description:
suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:107416]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40350 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40350
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048843 Nonsense 70 117 3 5
Genomic Location (Zv9):
Chromosome 5 (position 3107530)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 2791725
GRCz11 5 3121457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACGTCTTTTTTGCAGTGTTATTGCTATGATGAGTCCAGAAGACAGCTG[G/A]GTGGCAAAATGGCAGAGGATCGGTGAGTGTTTTATATACAGATTGATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link