si:dkey-267i17.6

Ensembl ID:
ENSDARG00000033104
ZFIN ID:
ZDB-GENE-060526-280
Description:
Novel protein similar to vertebrate transmembrane channel-like 2 (TMC2) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
TMC2
Human Description:
transmembrane channel-like 2 [Source:HGNC Symbol;Acc:16527]
Mouse Orthologue:
Tmc2
Mouse Description:
transmembrane channel-like gene family 2 Gene [Source:MGI Symbol;Acc:MGI:2151017]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44620 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11141 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073638 Essential Splice Site 66 430 2 9
ENSDART00000144087 Essential Splice Site 261 761 7 17
Genomic Location (Zv9):
Chromosome 5 (position 55833548)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54618218
GRCz11 5 55241054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGAGACAGCTGACAATAAATACGCCTCCATCACCACCAGCTTCAAAG[T/A]ATGTGCTTATGTGCATTTGTGGAAATGATTGGGTAGGTGTTCATGTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073638 Essential Splice Site 388 430 9 9
ENSDART00000144087 Essential Splice Site 583 761 14 17
Genomic Location (Zv9):
Chromosome 5 (position 55840195)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54624865
GRCz11 5 55247701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAACTTATMTTATGAACATTTATTCATAACTGTTCATYCTGTTACTGTA[G/A]TGGAAAGGAAAGAATGTTYGACGTTGTTATGGAGACCATTGATCTGGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link