
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-379f5.1
- Ensembl ID:
- ENSDARG00000033071
- ZFIN ID:
- ZDB-GENE-091113-36
- Human Orthologue:
- TRIM35
- Human Description:
- tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
- Mouse Orthologue:
- Trim35
- Mouse Description:
- tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19950 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19950
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031885 | Essential Splice Site | 248 | 454 | 5 | 6 |
ENSDART00000142691 | Essential Splice Site | 255 | 461 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 3 (position 8880526)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 8417993 GRCz11 3 8295735 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTCTCTCTGCTTCTGAATCCTGCAGTTCTGACTCCTGAATGTTCTTCC[A/T]GAGTCCAGATCTCACAGCCGGATCCACAGACGCCTTCTGGAGCTTTGATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: