zgc:194800

Ensembl ID:
ENSDARG00000032933
ZFIN ID:
ZDB-GENE-081022-150
Description:
protein deltex-2 [Source:RefSeq peptide;Acc:NP_001120779]
Human Orthologue:
DTX2
Human Description:
deltex homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:15973]
Mouse Orthologue:
Dtx2
Mouse Description:
deltex 2 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1921448]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15806 Nonsense Available for shipment Available now
sa33736 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055350 Nonsense 145 566 2 9
Genomic Location (Zv9):
Chromosome 5 (position 61257881)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58890008
GRCz11 5 59559717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTGGGAGTGGTCTAATGATGAAGGCGGATGGACGGCGTATGAGATA[C/T]GAACCTCCATCTTGCTGGAGCACAGTTACCAGGCGGGACAGGCCACCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055350 Essential Splice Site None 566 8 9
Genomic Location (Zv9):
Chromosome 5 (position 61292318)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58924445
GRCz11 5 59594154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTACTTTACAAATCACCTATTGGTAAACTTTTCAGTTTTTGAATCCAAT[T/A]GAACTAATCTCCAGGTCTGTTGAAAGCTTAACTTAATGTTTAAGTTTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link