cnksr1

Ensembl ID:
ENSDARG00000032932
ZFIN ID:
ZDB-GENE-040426-1802
Description:
connector enhancer of kinase suppressor of ras 1 [Source:RefSeq peptide;Acc:NP_991222]
Human Orthologue:
CNKSR1
Human Description:
connector enhancer of kinase suppressor of Ras 1 [Source:HGNC Symbol;Acc:19700]
Mouse Orthologue:
Cnksr1
Mouse Description:
connector enhancer of kinase suppressor of Ras 1 Gene [Source:MGI Symbol;Acc:MGI:2670958]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42946 Nonsense Mutation detected in F1 DNA During 2018
sa6479 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45610 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050018 Nonsense 80 780 3 21
Genomic Location (Zv9):
Chromosome 17 (position 26880149)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 27020068
GRCz11 17 27038459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTCCCCATGTCTGCACAGACCTACAGTGTTGGGGGTGACAGTCTG[C/T]GAAGTTTGACGGAGAAGCTTCGTGCAGTGGCACATACTCTGCAGATGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050018 Essential Splice Site 180 780 5 21
Genomic Location (Zv9):
Chromosome 17 (position 26865504)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 27005423
GRCz11 17 27023814
KASP Assay ID:
554-4881.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTAGGAAACCGCTGTGTTTGAAAAGGAGAAGGAMATCATATCCATAG[T/A]AAGTTCACTCTTACTTTTTTCATGACTCTTGATTCTTTGATTTAATACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050018 Nonsense 358 780 11 21
Genomic Location (Zv9):
Chromosome 17 (position 26847144)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26987063
GRCz11 17 27005454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGCGGGAGAAATCGGCTCTCGCTAATGATCAAAGCTCCAATGAATA[T/A]CAGTCAGGCACCCTAAAACGGCTTCAGCCAGGAACAGGTAAGAGTCGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link