
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ugt5g1
- Ensembl ID:
- ENSDARG00000032862
- ZFIN ID:
- ZDB-GENE-080305-10
- Description:
- UDP glucuronosyltransferase 5 family, polypeptide G1 [Source:RefSeq peptide;Acc:NP_001107914]
- Human Orthologue:
- UGT8
- Human Description:
- UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
- Mouse Orthologue:
- Ugt8a
- Mouse Description:
- UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25361 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa25361
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041615 | Essential Splice Site | None | 528 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 23861928)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 22423680 GRCz11 7 22694837 - KASP Assay ID:
- 554-7336.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTAAATTGTAAACATCTTGCTCTCTATCTCTCTCTCTCTTTGCACTTTTA[A/G]GCTTTGTGAAAGATGGATATGAGCTCCAAATGGTTATCTGCACTGACTTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: