ugt5g1

Ensembl ID:
ENSDARG00000032862
ZFIN ID:
ZDB-GENE-080305-10
Description:
UDP glucuronosyltransferase 5 family, polypeptide G1 [Source:RefSeq peptide;Acc:NP_001107914]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25361 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041615 Essential Splice Site None 528 4 4
Genomic Location (Zv9):
Chromosome 7 (position 23861928)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22423680
GRCz11 7 22694837
KASP Assay ID:
554-7336.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAATTGTAAACATCTTGCTCTCTATCTCTCTCTCTCTTTGCACTTTTA[A/G]GCTTTGTGAAAGATGGATATGAGCTCCAAATGGTTATCTGCACTGACTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link