zgc:154088

Ensembl ID:
ENSDARG00000032769
ZFIN ID:
ZDB-GENE-061013-597
Description:
Putative sodium-coupled neutral amino acid transporter 9 [Source:UniProtKB/Swiss-Prot;Acc:Q08BA4]
Human Orthologue:
SLC38A9
Human Description:
solute carrier family 38, member 9 [Source:HGNC Symbol;Acc:26907]
Mouse Orthologue:
Slc38a9
Mouse Description:
solute carrier family 38, member 9 Gene [Source:MGI Symbol;Acc:MGI:1918839]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7342 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041068 Missense 207 549 7 15
Genomic Location (Zv9):
Chromosome 10 (position 6585133)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6961649
GRCz11 10 6920349
KASP Assay ID:
554-4220.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRTCTTCTCGTTGGTGTCACTGATTGGTGCAATGGTGGTCTACTGGGTGC[T/C]CATGTCYAACTTCCTGTTCAATACGGGAAAATTCATTTTCAGTACGTGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link