net1

Ensembl ID:
ENSDARG00000032765
ZFIN ID:
ZDB-GENE-041121-18
Description:
neuroepithelial cell-transforming gene 1 protein [Source:RefSeq peptide;Acc:NP_001007768]
Human Orthologue:
NET1
Human Description:
neuroepithelial cell transforming 1 [Source:HGNC Symbol;Acc:14592]
Mouse Orthologue:
Net1
Mouse Description:
neuroepithelial cell transforming gene 1 Gene [Source:MGI Symbol;Acc:MGI:1927138]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33416 Nonsense Mutation detected in F1 DNA During 2018
sa40244 Nonsense Mutation detected in F1 DNA During 2018
sa33415 Nonsense Available for shipment Available now
hu2165 Nonsense Confirmed mutation in F2 line Unknown
sa40243 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002682 Nonsense 8 580 1 11
ENSDART00000049066   None 551 None 9

The following transcripts of ENSDARG00000032765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 10658649)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11595276
GRCz11 4 11594125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCTTTCTCTGTATCGGTTCTGCAGACCATGATGCAGTGTCACAGGAGA[C/T]AGAGCTACACCAGGCTTGGTGTGTGGTACGTACAGGATGTGTCTTTACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002682 Nonsense 21 580 2 11
ENSDART00000049066   None 551 None 9

The following transcripts of ENSDARG00000032765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 10658400)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11595027
GRCz11 4 11593876
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAAACTTATTTGTCTTGTGCTTTTCTCTTTGTAGGCCATCTTTGAGA[C/T]GAGGAAGCTCTTTTACCTTTCTGACACCTGGACCTCAGTGGGACTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002682 Nonsense 261 580 8 11
ENSDART00000049066 Nonsense 232 551 6 9

The following transcripts of ENSDARG00000032765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 10641101)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11577728
GRCz11 4 11576577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTAGCTGCCAAAGCCCTCCTCGATCAGAAGAAACAGGACCCAAGAGTT[C/T]AAGACTTCCTGCAGCGCTGCCTTGAGTCACCTTTCAGCAGGAAACTAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2165
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002682 Nonsense 287 580 8 11
ENSDART00000049066 Nonsense 258 551 6 9

The following transcripts of ENSDARG00000032765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 10641022)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11577649
GRCz11 4 11576498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTTCAGCAGGAAACTAGACTTATGGAGCTTCCTGGACATCCCTCGCT[C/G]ACGTTTGGTCAAATACCCTCTTCTTCTGAAAGAGATTTTAAGACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002682 Nonsense 464 580 11 11
ENSDART00000049066 Nonsense 435 551 9 9

The following transcripts of ENSDARG00000032765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 10639708)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11576335
GRCz11 4 11575184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTCAGGGACAGTCGCACACACTGCAGGTCAACGACGTCTTCCACAAG[C/T]AACAGTGGCTCAACTGCCTCCGCAATGCCATGTCCACCCAGAAGGATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link