ENSDARG00000032630 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

neb

Ensembl ID:: ENSDARG00000032630
ZFIN ID:: ZDB-GENE-041111-216
Description:: Novel protein similar to vertebrate nebulin (NEB) [Source:UniProtKB/TrEMBL;Acc:B0UY60]
Human Orthologue:: NEB
Human Description:: nebulin [Source:HGNC Symbol;Acc:7720]

Alleles

There are 21 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa154	Nonsense	Confirmed mutation in F2 line	During 2018
sa41408	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa906	Nonsense	Available for shipment	Available now
sa34630	Nonsense	Mutation detected in F1 DNA	During 2018
sa10635	Nonsense	Available for shipment	Available now
sa15371	Nonsense	Available for shipment	Available now
hu2849	Essential Splice Site	Confirmed mutation in F2 line	Unknown
sa15997	Nonsense	Available for shipment	Available now
sa16506	Nonsense	Available for shipment	Available now
sa34629	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa34628	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa34627	Nonsense	Mutation detected in F1 DNA	During 2018
sa21476	Essential Splice Site	Available for shipment	Available now
sa34626	Nonsense	Available for shipment	Available now
sa38738	Nonsense	Mutation detected in F1 DNA	During 2018
sa11973	Nonsense	Available for shipment	Available now
sa11545	Essential Splice Site	Available for shipment	Available now
sa1610	Essential Splice Site	Confirmed mutation in F2 line	During 2018
sa21475	Essential Splice Site	Available for shipment	Available now
sa18354	Essential Splice Site	Available for shipment	Available now
sa30646	Essential Splice Site	Mutation detected in F1 DNA	During 2018

Mutation Details

Allele Name:: sa154
Current Status:: Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Nonsense	58	6235	2	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Nonsense	81	6177	5	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23914397)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23070183
GRCz11	9	22881052

KASP Assay ID:

554-0041.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AGGGGCAGCCCTACCTCATTTCGGCTGACACACCTGAGATGATTCGCATC[A/T]AAAAGGCCCAGGAGCAGCTAAGTGAGGTATGAACTGTACTATTGGGGGAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa41408
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Essential Splice Site	666	6235	19	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Essential Splice Site	689	6177	22	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23902181)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23057967
GRCz11	9	22868836

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AAACTTTAGAAAATATTTTACAGTTATCAACCAACTGCATTTGTTCTCCT[A/T]GAAAAAATACAGGCAGCACCCAGACACCGTACCTTTTACTGCTATAGATG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa906
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Nonsense	1288	6235	30	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Nonsense	1311	6177	33	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23895131)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23050917
GRCz11	9	22861786

KASP Assay ID:

554-0813.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

ACGTTGGCTTCCGTAGCATCCAGGACGATCCCTTGCTGGTGCACTACATG[C/T]AGGTGGCAAAGATGCAGAGCGAGAGGAACTACAAGAAAGATTACCACAAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa34630
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Nonsense	1554	6235	34	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Nonsense	1559	6177	37	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23893911)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23049697
GRCz11	9	22860566

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TGGTGCACTACATGCAGGTGGCAAAGATGCAGAGCGAGAGGAACTACAAG[A/T]AAGATTACCACAAGTCCAAGCTGAAATACCACACCCCTGTGGACATGCTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa10635
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Nonsense	1929	6235	40	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Nonsense	1934	6177	43	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23891300)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23047086
GRCz11	9	22857955

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GTCYCAGTATGTTTTTGAAGATTTTAAAACTGGCTTTGTTTTTCCTTCAG[C/T]AAAAGTACATTTCYGCATGGGAAAAGGACAAAACCACAATCCACATTATG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa15371
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Nonsense	2002	6235	42	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Nonsense	2007	6177	45	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23890907)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23046693
GRCz11	9	22857562

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GGTAYTGTGAAAGTGATTAATGTTTTAATGAACTTATCGCAGTACAAGTA[C/A]AAAGCYGGGTATCGTAAGCAAGTCGGTCACCACATTGGAGCTCGCAGTRT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: hu2849
Current Status:: Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Unknown
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Essential Splice Site	2171	6235	43	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Essential Splice Site	2176	6177	46	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23890303)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23046089
GRCz11	9	22856958

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AAGACATGCCAATGGTCTTGGCCAAAGCCAATAATGATATCATGAATAAG[G/A]TCAGGTGCATATTTCATATCCAGACATATGAAATATATCTAAAATGTTAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa15997
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Nonsense	2285	6235	46	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Nonsense	2290	6177	49	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23889582)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23045368
GRCz11	9	22856237

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TCATGCTGGCCTTGAACTCAGCTAAGATTGCTAGTGATGCTCTGTACAAG[A/T]AAGACTTCAAMAAGTCTAAGACCAAGTTCCACCTCCCGGTGGACCTTCTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa16506
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Nonsense	2349	6235	47	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Nonsense	2354	6177	50	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23889186)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23044972
GRCz11	9	22855841

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

AGCTGCNTGAATGTTTTCTTTAAACATAATKTCTGCTTTTAGGCGGTGTA[C/A]AAAGCTGRTCTAAAATGGCTTCRAGGTCTTGGATGGGTTCCTATTGGTTC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa34629
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > G
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Essential Splice Site	2449	6235	48	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Essential Splice Site	2454	6177	51	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23888759)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23044545
GRCz11	9	22855414

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TGCAATGGACATTGTACTAGCAAAACAAAACAGGGTCAACTACAGTTTGG[T/G]AAGTATAAGGGTGCTTTCGCACCTGCCTTATTTAGTTTGGTTGAATCATA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa34628
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Essential Splice Site	2657	6235	51	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Essential Splice Site	2662	6177	54	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23886965)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23042751
GRCz11	9	22853620

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CGGATATGCCAATGGTCTTGGCAAAAGCCAATGCAAGCATCATGAACAAG[G/A]TAGCCTGCTTTGAACACTAAATGTTTCTTTCTTTTCATTGCAATGTGTAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa34627
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Nonsense	2729	6235	54	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Nonsense	2734	6177	57	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23886369)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23042155
GRCz11	9	22853024

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TCTTAAAGATTAATTTATTTTTATTGTCTTTTAATAATTTAAATGTAGTA[C/A]AAGTACAAGACTGGTTATCGTAAGCAAGTTGGTCATCACATTGGAGCTCG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa21476
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Essential Splice Site	3421	6235	64	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Essential Splice Site	3426	6177	67	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23883195)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23038981
GRCz11	9	22849850

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

ACACCCCTGAGATCATCCTTGGAAAACAGAATAAACTCAACACAAGCATT[G/A]TAAGTGCAGCAGCACTGCTTTGTAGTAACCAATAAATCTTGAATAAATGT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa34626
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Nonsense	4021	6235	75	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Nonsense	4026	6177	78	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23879450)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23035236
GRCz11	9	22846105

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AACATGCAAAGAAGTGCCAGATCCAAGTCAATGACGATAAATACAGAACT[C/T]GACTGCACCAGTGGACATGCTTGCCTGATCAGAATGATGTCATTCAGGCC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa38738
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Nonsense	4283	6235	81	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Nonsense	4252	6177	83	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23877987)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23033773
GRCz11	9	22844642

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TGCACCAGTGGACATGCCACCCTGAACAGAATGATGCCATCCGAGCACGC[A/T]AGGCCAATGAGATCTTGAGTGATGTAGGTTACTATTACAGTTATTCTGAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa11973
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Nonsense	4476	6235	87	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Nonsense	4445	6177	89	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23876861)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23032647
GRCz11	9	22843516

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TAAACCTTGTCGTAATSTTTTRTCTCTTAGCGCCTGTACAAAGAAAACTA[T/A]GAGAAGACCAAAGCAAAAATCAATGTACCTCCCGACATGCTTGACATCGT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa11545
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Essential Splice Site	4535	6235	87	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Essential Splice Site	4504	6177	89	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23876683)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23032469
GRCz11	9	22843338

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

ACATGCAGGTGTACGTACATGCCCGYAAAGKCAATGAGCAACTGAGCGAC[G/T]TAAGTGACATRAAAGTTATAGCRAAGTCAAGTCAGAGTGCTAACTGGAAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa1610
Current Status:: Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Essential Splice Site	5062	6235	103	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Essential Splice Site	5031	6177	105	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23872277)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23028063
GRCz11	9	22838932

KASP Assay ID:

554-1551.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TAACAAAGCTTTRTCATACTTATTTGCTGCTGTTTAATTGTGTTTTTGAC[A/T]GAGACTCTACAAAGCATCATTTGAGAAAAACAGAGCCAACTTCAAGTACA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa21475
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: A > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Essential Splice Site	5097	6235	104	134
ENSDART00000101711		None	610	None	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585		None	564	None	15
ENSDART00000143888	Essential Splice Site	5066	6177	106	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23871807)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23027593
GRCz11	9	22838462

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TCACTGCTCTCGAGGCAGTTGTCTTTAACTCCAATTTTGAAATTCTGAGC[A/C]GAGGTCCTACCGTGCCAGCTATGAGAAGTCTAAGGATAAGTACACCATAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa18354
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130		None	334	None	8
ENSDART00000061293	Essential Splice Site	5586	6235	117	134
ENSDART00000101711	Essential Splice Site	156	610	5	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585	Essential Splice Site	47	564	2	15
ENSDART00000143888	Essential Splice Site	5555	6177	119	135
ENSDART00000146486	Essential Splice Site	174	388	5	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23863867)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	23019653
GRCz11	9	22830522

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

ACAGCAAGATATATCAGACTCTGAAGGATGCTAATACACTTGCAAGCGAG[G/T]TGCTTTTAAGACTAAAACATTTTTTNNNNNNNNNNGTCTATTTATAAATATTACCMATCA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa30646
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000032130	Essential Splice Site	243	334	7	8
ENSDART00000061293	Essential Splice Site	6144	6235	133	134
ENSDART00000101711	Essential Splice Site	519	610	16	17
ENSDART00000142020		None	175	None	6
ENSDART00000142585	Essential Splice Site	473	564	14	15
ENSDART00000143888	Essential Splice Site	6086	6177	134	135
ENSDART00000146486		None	388	None	11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 9 (position 23839498)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	22995284
GRCz11	9	22806153

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TTGATTGAAAGTACACTAATGCAGTGAAACCCCTGTTGTTCTCTCATACA[G/A]GATACACACAGACCAAGACCATTGAGGTTCAGCAGAGATCTTCCTCAGTG

Associated Phenotype:

Not determined

OMIM

Nemaline myopathy 2, autosomal recessive

More OMIM information for NEB

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: