st7l

Ensembl ID:
ENSDARG00000032603
ZFIN ID:
ZDB-GENE-080219-43
Description:
Suppressor of tumorigenicity 7 protein-like [Source:UniProtKB/Swiss-Prot;Acc:A9JRA0]
Human Orthologue:
ST7L
Human Description:
suppression of tumorigenicity 7 like [Source:HGNC Symbol;Acc:18441]
Mouse Orthologue:
St7l
Mouse Description:
suppression of tumorigenicity 7-like Gene [Source:MGI Symbol;Acc:MGI:2386964]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17643 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103425 Nonsense 197 540 6 15
Genomic Location (Zv9):
Chromosome 6 (position 48250923)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48311575
GRCz11 6 48310334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGAGTCTAATGATGGTAGATGYTTCWCTTGTTTGTCCGRCAGTGATG[C/T]AGAAGGCCTGGAGGGAGAGGAACCCRCAGGCACGCATTCGAGCAGCTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: Meta-analysis of genome-wide association studies identifies common variants associated with blood pressure variation in east Asians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link