zgc:65960

Ensembl ID:
ENSDARG00000032601
ZFIN ID:
ZDB-GENE-040426-1490
Description:
MACRO domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_956843]
Mouse Orthologue:
4933409G03Rik
Mouse Description:
RIKEN cDNA 4933409G03 gene Gene [Source:MGI Symbol;Acc:MGI:3045336]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2706 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa2706
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043753 Essential Splice Site 212 247 10 12
ENSDART00000133370 Essential Splice Site 236 271 11 13
Genomic Location (Zv9):
Chromosome 13 (position 34783764)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34428209
GRCz11 13 34554215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATAAAAATGTCACCGCAACCAAGGAGAACACCAGCAGCAGCACTAAAG[G/A]TAAAAACAAAGATTTRTAATATTTCTTATCTTCTTTTTTTGTGTGAATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link