thnsl2

Ensembl ID:
ENSDARG00000032584
ZFIN IDs:
ZDB-GENE-051127-19, ZDB-GENE-051127-19
Description:
Threonine synthase-like 2 [Source:UniProtKB/Swiss-Prot;Acc:Q2YDP8]
Human Orthologue:
THNSL2
Human Description:
threonine synthase-like 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:25602]
Mouse Orthologue:
Thnsl2
Mouse Description:
threonine synthase-like 2 (bacterial) Gene [Source:MGI Symbol;Acc:MGI:3041254]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26639 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044786 Nonsense 23 369 2 8
ENSDART00000127508 Nonsense 23 476 2 9
Genomic Location (Zv9):
Chromosome 5 (position 75218414)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71319656
GRCz11 5 72104162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGCCGGCGTTCAGGGCCGCAGCTTCAGAGATGTGCTGTTCTCCGGATA[C/A]GCCGCAGACGGAGGAATGTTCATGCCGGAGAATCTGCCGTCGCTCTCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link