si:dkey-236e20.6

Ensembl ID:
ENSDARG00000032516
ZFIN ID:
ZDB-GENE-030131-9751
Description:
hypothetical protein LOC321183 [Source:RefSeq peptide;Acc:NP_001073413]
Human Orthologue:
RRP36
Human Description:
ribosomal RNA processing 36 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:21374]
Mouse Orthologue:
Rrp36
Mouse Description:
ribosomal RNA processing 36 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2385053]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43800 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17913 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045682 Essential Splice Site 235 320 7 8
Genomic Location (Zv9):
Chromosome 22 (position 15497080)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15325089
GRCz11 22 15351472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAATACTGCAGTTTATTTAATCACTGTGCATATGTGTGTGTAATACA[G/A]GACAACCAGCAGAGGGCCCGACAGAGACAAGAACAGGAGAGAGAAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045682 Nonsense 298 320 8 8
Genomic Location (Zv9):
Chromosome 22 (position 15497900)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15325909
GRCz11 22 15352292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGGAGAAKTACAGYGAGCTTAAAAAGWGTGGAAAACTGGAGAACTTCT[T/A]GAGTAAGAAGAGGAAACGCAACGCYACAAAGGATCGCAGAAAGTTGCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link