ampd3

Ensembl ID:
ENSDARG00000032469
ZFIN ID:
ZDB-GENE-030131-5929
Description:
AMP deaminase 3 [Source:RefSeq peptide;Acc:NP_956142]
Human Orthologue:
AMPD3
Human Description:
adenosine monophosphate deaminase 3 [Source:HGNC Symbol;Acc:470]
Mouse Orthologue:
Ampd3
Mouse Description:
adenosine monophosphate deaminase 3 Gene [Source:MGI Symbol;Acc:MGI:1096344]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36613 Nonsense Mutation detected in F1 DNA During 2018
sa36612 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048722 Nonsense 12 779 2 16
ENSDART00000093095   None 196 None 15
ENSDART00000145546   None 188 None 4
ENSDART00000148222   None 196 None 4
Genomic Location (Zv9):
Chromosome 18 (position 16454109)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16805875
GRCz11 18 16794941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCTGTGCTGTCAAAATGAGCAAAAAAGGAACCCCTCTGTCTAAGCAA[C/T]AATCAACACCCAACTTTGGGAGGGGTAAGTTTGGCACAGTGTATGATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048722 Essential Splice Site 208 779 5 16
ENSDART00000093095 Essential Splice Site 196 196 4 15
ENSDART00000145546   188 188 4 4
ENSDART00000148222   196 196 4 4
Genomic Location (Zv9):
Chromosome 18 (position 16439675)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16791441
GRCz11 18 16780507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGAGTGCCAATAATGAAAAGTGGAGTGAGGATGAAGAAGTGCTGCCAG[G/A]TATGTTGTGGTTGGCAACAGTTCATGCACAATGCACAATTAACTGTCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link