zgc:63474

Ensembl ID:
ENSDARG00000032435
ZFIN ID:
ZDB-GENE-040426-1129
Description:
Zgc:63474 protein [Source:UniProtKB/TrEMBL;Acc:Q7SYE6]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35591 Nonsense Mutation detected in F1 DNA During 2018
sa8743 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045475 Nonsense 132 210 3 6
Genomic Location (Zv9):
Chromosome 13 (position 49012107)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 47748879
GRCz11 13 48040119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGTGTCAAGGCGACAGGAACGACGAGTGGATGGGGGTCAGTCTGGCT[C/T]GACAGAATAAACCCAACGGCAAAATTTTGGTATGATCCATTTAAACCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045475 Essential Splice Site 183 210 5 6
Genomic Location (Zv9):
Chromosome 13 (position 48987951)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 47724723
GRCz11 13 48015963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTYNNCCTTTCTCTTTCTCTTYCTCTCTCTCCCCCTACTCACTCTCGC[A/T]GACCATAAGAAGACCTMTGGGGAAGAACATGGCTCGTGCCAAGCCGGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link