
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rnf145
- Ensembl ID:
- ENSDARG00000032373
- ZFIN ID:
- ZDB-GENE-030131-5264
- Description:
- RING finger protein 145 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZWF4]
- Human Orthologue:
- RNF145
- Human Description:
- ring finger protein 145 [Source:HGNC Symbol;Acc:20853]
- Mouse Orthologue:
- Rnf145
- Mouse Description:
- ring finger protein 145 Gene [Source:MGI Symbol;Acc:MGI:1921565]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23987 | Nonsense | Available for shipment | Available now |
sa32353 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23987
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047515 | None | 685 | 1 | 11 | |
ENSDART00000138575 | Nonsense | 5 | 77 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 21 (position 32998341)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 33998034 GRCz11 21 34032524 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAATAAACGGATAACGCGGAGAAGTTGGACCTAAAGATGATTTATATTTA[T/A]CCAGAAGCGCACACAAAGACGAAATCTAACAGCGTGAAGTGACTGGATAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32353
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047515 | Nonsense | 386 | 685 | 9 | 11 |
ENSDART00000138575 | None | 77 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 21 (position 32982869)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 33982562 GRCz11 21 34017052 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTGTTCTTGCAGGAGTTTGTGGAAGCACTTCCGAGCAGTTAGTCTTTG[T/A]CTTTTCTTACTGGTCTTCCCTGCTTACATGGCTTACATGATTTGCCAGTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: