usp36

Ensembl ID:
ENSDARG00000032327
ZFIN ID:
ZDB-GENE-030131-5450
Description:
Ubiquitin carboxyl-terminal hydrolase [Source:UniProtKB/TrEMBL;Acc:Q6PFP7]
Human Orthologue:
USP36
Human Description:
ubiquitin specific peptidase 36 [Source:HGNC Symbol;Acc:20062]
Mouse Orthologue:
Usp36
Mouse Description:
ubiquitin specific peptidase 36 Gene [Source:MGI Symbol;Acc:MGI:1919594]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26165 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25266 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047503 Essential Splice Site None 912 None 17
ENSDART00000123883 Essential Splice Site None 755 None 17
ENSDART00000124540   None 1104 None 20
ENSDART00000129598 Essential Splice Site None 1104 None 21
Genomic Location (Zv9):
Chromosome 3 (position 58444564)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 57560152
GRCz11 3 57630676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTTAACATCAAAACACACCCGTCGATTCGCGATCATTCACGGATGGG[T/A]ACGTATGGAATGCTATTTCCGTGTGTTCACCGTGAAAATAACGTGCGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047503 Nonsense 118 912 3 17
ENSDART00000123883 Nonsense 118 755 3 17
ENSDART00000124540 Nonsense 118 1104 2 20
ENSDART00000129598 Nonsense 118 1104 3 21
Genomic Location (Zv9):
Chromosome 3 (position 58428162)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 57543750
GRCz11 3 57614274
KASP Assay ID:
554-7314.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATGCTCTTTCCAGGGAACAAGCTGTCCATGAAGTGGGAACGGGTGTA[T/A]CGGGTTGGAGCCGGCCTCCACAACCTGGGCAACACCTGCTTCCTCAACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link