Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tox
- Ensembl ID:
- ENSDARG00000032317
- ZFIN ID:
- ZDB-GENE-070912-181
- Description:
- Novel protein similar to thymocyte selection-associated high mobility group box (TOX) [Source:UniPro
- Human Orthologue:
- TOX
- Human Description:
- thymocyte selection-associated high mobility group box [Source:HGNC Symbol;Acc:18988]
- Mouse Orthologue:
- Tox
- Mouse Description:
- thymocyte selection-associated high mobility group box Gene [Source:MGI Symbol;Acc:MGI:2181659]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa15155 | Nonsense | Available for shipment | Available now |
| sa38325 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15155
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000044371 | Nonsense | 71 | 539 | 3 | 10 |
| ENSDART00000132039 | Nonsense | 49 | 225 | 2 | 4 |
| ENSDART00000134912 | Nonsense | 71 | 203 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 2 (position 21839512)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 22384927 GRCz11 2 22042989 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTAGTTCCGYGTTCCTGCGAGTCCCAGCCAGACGCAGCACAGCAACAAA[C/T]AGGCCGGCGGACACTGGAAAAGAGAGACCCAGACACACACGGATGGCCAY
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38325
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000044371 | Nonsense | 160 | 539 | 4 | 10 |
| ENSDART00000132039 | Nonsense | 138 | 225 | 3 | 4 |
| ENSDART00000134912 | Nonsense | 161 | 203 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 2 (position 21854791)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 22400206 GRCz11 2 22058268 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTCACCTGCAAGGAATGGACCTGCCCGGCATGTTGAGTCCTAATATGT[T/A]GAGCCAAGATGGCAGCCTGCTCACCAACTCTCTCTCAGTGGTGAGTACAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cognitive performance: A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB. (View Study)
- Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
- Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
