zgc:92775

Ensembl ID:
ENSDARG00000032296
ZFIN ID:
ZDB-GENE-040801-10
Description:
proteasome maturation protein [Source:RefSeq peptide;Acc:NP_001003424]
Human Orthologue:
POMP
Human Description:
proteasome maturation protein [Source:HGNC Symbol;Acc:20330]
Mouse Orthologue:
Pomp
Mouse Description:
proteasome maturation protein Gene [Source:MGI Symbol;Acc:MGI:1913787]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31064 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045124 Essential Splice Site 121 142 5 6
Genomic Location (Zv9):
Chromosome 21 (position 39362932)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40691394
GRCz11 21 40714441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTTCGAGGCAGCGATGACACCATCGGCTTTGAGGACATTCTCAATGG[T/A]ATGAAGGAAACATCCATGATAATAGCACAAAAATCACCGGTCAAGTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link