zgc:113294

Ensembl ID:
ENSDARG00000032285
ZFIN ID:
ZDB-GENE-050320-124
Description:
Zgc:113294 [Source:UniProtKB/TrEMBL;Acc:Q5BJB1]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17015 Nonsense Available for shipment Available now
sa39017 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046783 Nonsense 117 332 3 3
Genomic Location (Zv9):
Chromosome 15 (position 820403)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 860706
GRCz11 15 821509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAGTACCTWATAGAACAYATGACAATTCACAATGGAGAAAAGCCTTA[C/A]ACTTGCCAACAGTGTGGAAAGARTTTCACTTGGAAACAAAACCTGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046783 Nonsense 242 332 3 3
Genomic Location (Zv9):
Chromosome 15 (position 820776)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 861079
GRCz11 15 821882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCAAGGCTCACGCCTGCAATCAGTGTGGAAAAAGTTTCACTCGGAAA[C/T]AAAACCTTGTCGACCATATGAAGATTCACACTGAAGGAAAGGCTCACACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link