
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mybl2
- Ensembl ID:
- ENSDARG00000032264
- ZFIN ID:
- ZDB-GENE-041007-1
- Description:
- myb-related protein B [Source:RefSeq peptide;Acc:NP_001003867]
- Human Orthologue:
- MYBL2
- Human Description:
- v-myb myeloblastosis viral oncogene homolog (avian)-like 2 [Source:HGNC Symbol;Acc:7548]
- Mouse Orthologue:
- Mybl2
- Mouse Description:
- myeloblastosis oncogene-like 2 Gene [Source:MGI Symbol;Acc:MGI:101785]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14950 | Essential Splice Site | Available for shipment | Available now |
sa35002 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa14950
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040577 | Essential Splice Site | 94 | 633 | 4 | 16 |
ENSDART00000121489 | Essential Splice Site | 94 | 633 | 4 | 15 |
ENSDART00000137479 | None | 240 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 11 (position 1519739)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 1527879 GRCz11 11 1554467 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- RGATCCTGATCTTGTYAAAGGACCCTGGACYAAGGAGGAGGACGAGAAGG[T/C]AAAATNNNNGTAGAGACTGCAGTGGAGTTAATGGATTATATCACWACAGTYWAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35002
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040577 | Nonsense | 316 | 633 | 9 | 16 |
ENSDART00000121489 | Nonsense | 316 | 633 | 9 | 15 |
ENSDART00000137479 | None | 240 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 11 (position 1527108)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 1535248 GRCz11 11 1561836 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACCATGTCGGACTTCGACCTGCCGGAGGAGAGCCAGAGCTCGGAGCTCT[T/A]GCAGTTTCGTCTGGAGGGCAGTGCACTGCAAGAGCTCAGCAAGGGCAGTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: