zgc:110224

Ensembl ID:
ENSDARG00000032263
ZFIN ID:
ZDB-GENE-050417-120
Description:
hypothetical protein LOC550335 [Source:RefSeq peptide;Acc:NP_001017642]
Human Orthologue:
RP11-849H4.2
Human Description:
Putative short transient receptor potential channel 2-like protein [Source:UniProtKB/Swiss-Prot;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37346 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040443 Nonsense 183 403 5 9
Genomic Location (Zv9):
Chromosome 21 (position 29500157)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30700408
GRCz11 21 30737103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATTGTGTTCACAGCGTACACCAGAAAAAATGTCATCCGTGATGGAGTG[G/A]CTTTCCAGTCCCGCTGTCCAAAACACGTTTTTTGGGCGAATCACAGGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link