zgc:101872

Ensembl ID:
ENSDARG00000032237
ZFIN ID:
ZDB-GENE-041212-10
Description:
anaphase-promoting complex subunit 4 [Source:RefSeq peptide;Acc:NP_001008589]
Human Orthologue:
ANAPC4
Human Description:
anaphase promoting complex subunit 4 [Source:HGNC Symbol;Acc:19990]
Mouse Orthologue:
Anapc4
Mouse Description:
anaphase promoting complex subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1098673]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15871 Nonsense Available for shipment Available now
sa1214 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa15871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040776 Nonsense 92 806 4 29
ENSDART00000058524 Nonsense 92 797 4 28
ENSDART00000146203 Nonsense 92 806 4 29
Genomic Location (Zv9):
Chromosome 20 (position 23479426)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23592813
GRCz11 20 23491913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGYGTGGGCGACACMAAGCAGGTGGTCCTGTGTGATGCAGAAAAGGCT[G/T]AAATCCTCCAYCTGTTCCCTGTGGAATATCCAGCATCCTGCATGCACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1214
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040776 Essential Splice Site 399 806 16 29
ENSDART00000058524 Essential Splice Site 390 797 15 28
ENSDART00000146203 Essential Splice Site 399 806 16 29
Genomic Location (Zv9):
Chromosome 20 (position 23471898)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23585285
GRCz11 20 23484385
KASP Assay ID:
554-1123.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCGTAGCAGTGGGCTCTTTTACCCTGAAGGCCAGCGAACTTTTACAG[T/A]GAGTTTAWTGTTATTCTGTCTACTGTGATCTTATTGTCTGCTCTGTATAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link