wnt2bb

Ensembl ID:
ENSDARG00000032234
ZFIN ID:
ZDB-GENE-060824-6
Description:
protein Wnt-2b [Source:RefSeq peptide;Acc:NP_001037809]
Human Orthologue:
WNT2B
Human Description:
wingless-type MMTV integration site family, member 2B [Source:HGNC Symbol;Acc:12781]
Mouse Orthologue:
Wnt2b
Mouse Description:
wingless related MMTV integration site 2b Gene [Source:MGI Symbol;Acc:MGI:1261834]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34423 Nonsense Mutation detected in F1 DNA During 2018
sa34424 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046004 Nonsense 257 396 4 5
Genomic Location (Zv9):
Chromosome 8 (position 28614441)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 27742359
GRCz11 8 27761498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGTAAATGTCATGGAGTCAGTGGCTCGTGCACCCTCAGAACCTGCTG[G/A]TTGGCAATGTCAGATTTACGTAAAACAGGAGATTACCTTCGCAAGAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046004 Nonsense 366 396 5 5
Genomic Location (Zv9):
Chromosome 8 (position 28621635)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 27749553
GRCz11 8 27768692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACCACACGCTCAAAACGCATCACCAAGTGCGAATGCAAGTTTAAGTG[G/A]TGTTGCACTGTAGAGTGCAAAGACTGCGAGGAGGCTGTCGACATTCACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link