
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gtf2f1
- Ensembl ID:
- ENSDARG00000032129
- ZFIN ID:
- ZDB-GENE-030131-4557
- Description:
- general transcription factor IIF subunit 1 [Source:RefSeq peptide;Acc:NP_956023]
- Human Orthologue:
- GTF2F1
- Human Description:
- general transcription factor IIF, polypeptide 1, 74kDa [Source:HGNC Symbol;Acc:4652]
- Mouse Orthologue:
- Gtf2f1
- Mouse Description:
- general transcription factor IIF, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1923848]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa26104 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa40105 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa26104
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026090 | Nonsense | 146 | 536 | 6 | 14 |
ENSDART00000047660 | Nonsense | 146 | 536 | 7 | 15 |
ENSDART00000111878 | Nonsense | 146 | 443 | 7 | 13 |
ENSDART00000122357 | Nonsense | 146 | 536 | 5 | 14 |
- Genomic Location (Zv9):
- Chromosome 3 (position 34020392)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 33805588 GRCz11 3 33935096 - KASP Assay ID:
- 2259-3721.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCACACAGAGTGCCGATGGTGCTTTTGAGGCATTTCCCGTGCACGCCTG[G/A]TATAACTTCACACCACAGGCCAAACACCGCACGCTCACAGCTGAGGAAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40105
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026090 | Essential Splice Site | 378 | 536 | 12 | 14 |
ENSDART00000047660 | Essential Splice Site | 378 | 536 | 13 | 15 |
ENSDART00000111878 | Essential Splice Site | 285 | 443 | 11 | 13 |
ENSDART00000122357 | Essential Splice Site | 378 | 536 | 11 | 14 |
- Genomic Location (Zv9):
- Chromosome 3 (position 34016197)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 33801393 GRCz11 3 33930901 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATTTCATGTGAATATGGTACAGTGCTTTTTTCTTGTTGTCTCTGTCACA[G/A]AAGAAGCGCACACCTCCTAAGCGAGGAGGTGGCCGTGGCTCAGCAGGCAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: