acsl3a
- Ensembl ID:
- ENSDARG00000032079
- ZFIN ID:
- ZDB-GENE-050420-181
- Description:
- acyl-CoA synthetase long-chain family member 3 [Source:RefSeq peptide;Acc:NP_001038593]
- Human Orthologue:
- ACSL3
- Human Description:
- acyl-CoA synthetase long-chain family member 3 [Source:HGNC Symbol;Acc:3570]
- Mouse Orthologue:
- Acsl3
- Mouse Description:
- acyl-CoA synthetase long-chain family member 3 Gene [Source:MGI Symbol;Acc:MGI:1921455]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa8864 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa16715 |
Nonsense |
Available for shipment |
Available now |
sa32062 |
Essential Splice Site |
Available for shipment |
Available now |
sa39067 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa35990 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa42620 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa8864
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000042884 |
Nonsense |
22 |
713 |
1 |
14 |
- Genomic Location (Zv9):
- Chromosome 15 (position 41726681)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
43052088 |
GRCz11 |
15 |
43008520 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GATTTGAGTCCAGCYGTGGTGCTTGTTTTCAGGCTGGTGGTTTGGCTGTA[T/G]TCCCTCATCTCCTACCTGCCGTACCTGTTGCTGAGATCACCTGAGTCTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16715
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000042884 |
Nonsense |
408 |
713 |
8 |
14 |
- Genomic Location (Zv9):
- Chromosome 15 (position 41783126)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
43108533 |
GRCz11 |
15 |
43064965 |
- KASP Assay ID:
- 2260-8978.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GAGCAAATGAGTGGATTTCAGAGGACTCTCTTTCTGCTGGCCYACAACTA[C/A]AAGATGGAGCAGCTGGCAATGGGATACAGCACTCCACTGTGTGATAAGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32062
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000042884 |
Essential Splice Site |
424 |
713 |
8 |
14 |
- Genomic Location (Zv9):
- Chromosome 15 (position 41783175)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
43108582 |
GRCz11 |
15 |
43065014 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAAGATGGAGCAGCTGGCAATGGGATACAGCACTCCACTGTGTGATAAG[T/C]GTGTCTCTCTTTTACTCACATACACACACACACACACACAAACACAATCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39067
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000042884 |
Nonsense |
443 |
713 |
9 |
14 |
- Genomic Location (Zv9):
- Chromosome 15 (position 41783364)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
43108771 |
GRCz11 |
15 |
43065203 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTCAGGAAGGTTCGGGCTCTGCTGGGTGGGCGTCTGCGTGTGTTGTTGT[C/A]AGGCGGAGCTCCTCTGTCTGCGGCGACCCAGCGCTTCATGAACATCTGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35990
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000042884 |
Nonsense |
504 |
713 |
10 |
14 |
- Genomic Location (Zv9):
- Chromosome 15 (position 41785532)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
43110939 |
GRCz11 |
15 |
43067371 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGAGAGTTGGAGCACCGCTGGTCTGCTGTGAACTTCAGCTGAAGGACTG[G/A]ATAGAGGGTGAGTCTCGTAGCATACACACATGCATATATCTGCTCTTATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42620
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000042884 |
Nonsense |
694 |
713 |
14 |
14 |
- Genomic Location (Zv9):
- Chromosome 15 (position 41796641)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
43122048 |
GRCz11 |
15 |
43078480 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGAGCCCTGGACCCCAGACACCGGCCTGGTTACAGACTCTTTCAAACTC[A/T]AGAGAAAGGAGCTAAAAACTCACTACCAGAACGACATCGAGAGGATGTAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: