slc15a2

Ensembl ID:
ENSDARG00000032010
ZFIN ID:
ZDB-GENE-030131-5866
Description:
solute carrier family 15 member 2 [Source:RefSeq peptide;Acc:NP_001034917]
Human Orthologue:
SLC15A2
Human Description:
solute carrier family 15 (H+/peptide transporter), member 2 [Source:HGNC Symbol;Acc:10921]
Mouse Orthologue:
Slc15a2
Mouse Description:
solute carrier family 15 (H+/peptide transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:1890457]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31735 Nonsense Available for shipment Available now
sa2503 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100622 Nonsense 107 719 5 23
ENSDART00000131756   None 206 None 7
Genomic Location (Zv9):
Chromosome 9 (position 38375114)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37513010
GRCz11 9 37322805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTATTTTTATTTTTTTGCAGAACCATCATCTATCTATCTATTGTGTA[T/A]GTGATTGGCCATGTGGTCAAGTCTGTCGGGGCCATTCCTGATGTGGGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100622 Essential Splice Site 539 719 19 23
ENSDART00000131756   None 206 None 7
Genomic Location (Zv9):
Chromosome 9 (position 38387210)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37525106
GRCz11 9 37334901
KASP Assay ID:
554-3030.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCTGCAAATTATGGGATTTCTCGCAATATAAGTGTACCAAGGGGAGAG[T/A]GAGTATTTTAATCCTACAATTGTACATTATCAATGTATAATTTCAAGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link