six4b

Ensembl ID:
ENSDARG00000031983
ZFIN ID:
ZDB-GENE-010201-1
Description:
sine oculis homeobox homolog 4b [Source:RefSeq peptide;Acc:NP_571792]
Human Orthologue:
SIX4
Human Description:
SIX homeobox 4 [Source:HGNC Symbol;Acc:10890]
Mouse Orthologue:
Six4
Mouse Description:
sine oculis-related homeobox 4 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106034]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15756 Nonsense Available for shipment Available now
sa14754 Nonsense Available for shipment Available now
sa23674 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048110 Nonsense 91 615 1 3
ENSDART00000112537 Nonsense 91 545 1 4
Genomic Location (Zv9):
Chromosome 20 (position 20557366)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20585533
GRCz11 20 20485206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCGCTGATGCAGGGTGGGAACGTGGACCGCCTGGCCAGGTTCCTGTG[G/A]TCACTACCGCAGAGTGACCTSCTGCGGGGGAACGAGAGCATCCTGAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048110 Nonsense 297 615 2 3
ENSDART00000112537 Nonsense 297 545 2 4
Genomic Location (Zv9):
Chromosome 20 (position 20559747)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20587914
GRCz11 20 20487587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACAGCCCCCCCTACAGTTTACTCAGACGGMGGAACAACAGTCATCCAR[C/T]AAATAGGAGATGTCAAAATGCCCTCACACTCAGGTGGAGGAATGAGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048110 Nonsense 302 615 2 3
ENSDART00000112537 Nonsense 302 545 2 4
Genomic Location (Zv9):
Chromosome 20 (position 20559762)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20587929
GRCz11 20 20487602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTTACTCAGACGGAGGAACAACAGTCATCCAACAAATAGGAGATGTC[A/T]AAATGCCCTCACACTCAGGTGGAGGAATGAGTTATAATGGTGACCTTGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link