
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
erc1b
- Ensembl ID:
- ENSDARG00000031930
- ZFIN ID:
- ZDB-GENE-041210-51
- Description:
- Novel protein similar to vertebrate Rab6-interacting protein 2 (RAB6IP2) [Source:UniProtKB/TrEMBL;Ac
- Human Orthologue:
- ERC1
- Human Description:
- ELKS/RAB6-interacting/CAST family member 1 [Source:HGNC Symbol;Acc:17072]
- Mouse Orthologue:
- Erc1
- Mouse Description:
- ELKS/RAB6-interacting/CAST family member 1 Gene [Source:MGI Symbol;Acc:MGI:2151013]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31376 | Nonsense | Available for shipment | Available now |
sa20205 | Nonsense | Available for shipment | Available now |
sa9013 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa33386 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa26218 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa31376
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027829 | Nonsense | 5 | 606 | 1 | 12 |
ENSDART00000132647 | None | 243 | None | 5 | |
ENSDART00000138653 | None | 144 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 4 (position 7895695)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 8263084 GRCz11 4 8270971 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAATAATAGTGTTTTAACGCACGTTAGCTGTCACTTCATGCATCTGTAC[C/T]AATGTCTTTTTCCCTGCGCATTTCAGGTCGATGCTCTGCGTTTGCGTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20205
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027829 | Nonsense | 34 | 606 | 1 | 12 |
ENSDART00000132647 | None | 243 | None | 5 | |
ENSDART00000138653 | None | 144 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 4 (position 7895608)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 8263171 GRCz11 4 8271058 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCGTTTGCGTCTGGAGGAGAAGGAGGCCACGCTGAATAAAAAGAGCAAG[C/T]AGATTCAAGAGGTGTCGGAGGAGAAAGGCACGCTCAACGGAGAAATTCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9013
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027829 | Essential Splice Site | 209 | 606 | 4 | 12 |
ENSDART00000132647 | None | 243 | None | 5 | |
ENSDART00000138653 | None | 144 | None | 4 | |
ENSDART00000027829 | Essential Splice Site | 209 | 606 | 4 | 12 |
ENSDART00000132647 | None | 243 | None | 5 | |
ENSDART00000138653 | None | 144 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 4 (position 7855381)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 8303398 GRCz11 4 8306078 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGAGCAGAAGAAAGAGGAGTGCATCAAACTGGAGAGTCAGCTCAAGAAG[G/A]TGAGCCCAGACACTTGAAGCATCAYRGCTAGCAAATACATCTCTCGTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33386
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027829 | Essential Splice Site | 209 | 606 | 4 | 12 |
ENSDART00000132647 | None | 243 | None | 5 | |
ENSDART00000138653 | None | 144 | None | 4 | |
ENSDART00000027829 | Essential Splice Site | 209 | 606 | 4 | 12 |
ENSDART00000132647 | None | 243 | None | 5 | |
ENSDART00000138653 | None | 144 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 4 (position 7855381)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 8303398 GRCz11 4 8306078 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGAGCAGAAGAAAGAGGAGTGCATCAAACTGGAGAGTCAGCTCAAGAAG[G/T]TGAGCCCAGACACTTGAAGCATCACGGCTAGCAAATACATCTCTCGTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26218
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027829 | Nonsense | 330 | 606 | 7 | 12 |
ENSDART00000132647 | None | 243 | None | 5 | |
ENSDART00000138653 | None | 144 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 4 (position 7805703)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 8353076 GRCz11 4 8354330 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATGTTTTTTTTATTCTTAGGATTCTTTGCGGCTGAAAGACGATCGCATC[G/T]AGGAGCTGGAGGAGGCTTTGCGTGAGAGCGTTCAGATCACTGCTGAGAGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: