
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NBL1
- Ensembl ID:
- ENSDARG00000031898
- Description:
- neuroblastoma, suppression of tumorigenicity 1 [Source:HGNC Symbol;Acc:7650]
- Human Orthologue:
- NBL1
- Human Description:
- neuroblastoma, suppression of tumorigenicity 1 [Source:HGNC Symbol;Acc:7650]
- Mouse Orthologue:
- Nbl1
- Mouse Description:
- neuroblastoma, suppression of tumorigenicity 1 Gene [Source:MGI Symbol;Acc:MGI:104591]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10101 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10101
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045844 | Essential Splice Site | 60 | 183 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 22 (position 107177)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 28681 GRCz11 22 64897 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACGCAGATCGTCGGACACACCGGCTGCACGCCACGATCCATCCAAAACAG[G/A]TCAGCCGCGCACACACACACACACACACACACACACACACACACACNNNANNN
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: