zgc:172209

Ensembl ID:
ENSDARG00000031888
ZFIN ID:
ZDB-GENE-080218-17
Description:
mitogen-activated protein kinase 8 [Source:RefSeq peptide;Acc:NP_001103859]
Human Orthologue:
MAPK8
Human Description:
mitogen-activated protein kinase 8 [Source:HGNC Symbol;Acc:6881]
Mouse Orthologue:
Mapk8
Mouse Description:
mitogen-activated protein kinase 8 Gene [Source:MGI Symbol;Acc:MGI:1346861]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28135 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6311 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10069 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa28135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049180 Essential Splice Site 41 427 None 11
ENSDART00000132129 Essential Splice Site 41 427 None 12
ENSDART00000139591 Essential Splice Site 41 427 None 12
ENSDART00000146250   None 88 None 3

The following transcripts of ENSDARG00000031888 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31388193)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31034141
GRCz11 13 31164591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATCAGAATCTAAGACCCATTGGCTCGGGTGCTCAGGGAATAGTCTGG[T/C]ATGTTCTAAGAGCTCGTATTCCACCTCAAATCAAGGACGTTACGCTGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049180 Essential Splice Site 84 427 None 11
ENSDART00000132129 Essential Splice Site 84 427 None 12
ENSDART00000139591 Essential Splice Site 84 427 None 12
ENSDART00000146250   None 88 None 3

The following transcripts of ENSDARG00000031888 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31387969)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31033917
GRCz11 13 31164367
KASP Assay ID:
554-5250.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTGCGTACAGAGAGCTGGTGCTCATGAAATGTGTCAACCATAAAAATG[T/C]AAGTCAAGACACTGAAATGACTYGTAACATGTTGCATTTTAYCCTGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049180 Essential Splice Site 290 427 7 11
ENSDART00000132129 Essential Splice Site 290 427 8 12
ENSDART00000139591 Essential Splice Site 290 427 8 12
ENSDART00000146250   None 88 None 3

The following transcripts of ENSDARG00000031888 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31381567)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31027515
GRCz11 13 31157965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCCTGATGTCCTGTTCCCTGCTGATTCAGAACACAGCAAACTAAAAG[G/A]TACTTCATCTACTYAATGYTTTCAAYGAGTGATCTTGTTTTTTGCAGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link