zgc:91936

Ensembl ID:
ENSDARG00000031814
ZFIN ID:
ZDB-GENE-040801-253
Description:
hypothetical protein LOC445116 [Source:RefSeq peptide;Acc:NP_001003510]
Human Orthologue:
TAPBPL
Human Description:
TAP binding protein-like [Source:HGNC Symbol;Acc:30683]
Mouse Orthologue:
Tapbpl
Mouse Description:
TAP binding protein-like Gene [Source:MGI Symbol;Acc:MGI:2384853]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35890 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42551 Nonsense Mutation detected in F1 DNA During 2018
sa28451 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045549 Essential Splice Site 82 318 None 5
ENSDART00000127558 Essential Splice Site 82 539 None 10
ENSDART00000130589 Essential Splice Site 104 340 None 5
ENSDART00000140658 Essential Splice Site 104 253 None 4

The following transcripts of ENSDARG00000031814 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 23918651)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24629838
GRCz11 15 24565103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCGTAGTCAAGTACGGGGCGAGGTTGCTGTGGCGCTTGTTAAGAGAG[T/A]GAGATCATTGTCCTTTATTTCTTCACTTAATAATATGTAATGATTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045549   None 318 None 5
ENSDART00000127558 Nonsense 225 539 5 10
ENSDART00000130589   None 340 None 5
ENSDART00000140658   None 253 None 4

The following transcripts of ENSDARG00000031814 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 23927280)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24638467
GRCz11 15 24573732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACTGGAGGAATAGTAATGCGCTGGCCTGTTGCAGGAGCACAAGAGTA[T/G]GACGTCTGGTTCACCTGCACATTACGTCATACACAAGGCTTGTTCGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045549   None 318 None 5
ENSDART00000127558 Essential Splice Site 386 539 7 10
ENSDART00000130589   None 340 None 5
ENSDART00000140658   None 253 None 4

The following transcripts of ENSDARG00000031814 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 23932032)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24643219
GRCz11 15 24578484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGCGCGCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTACTCTAC[A/T]GAACAGCCTCGTGTGTCTCTAAATGTGCCCAACACCTTGGCTATGGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link