ache

Ensembl ID:
ENSDARG00000031796
ZFIN ID:
ZDB-GENE-010906-1
Description:
Acetylcholinesterase [Source:UniProtKB/Swiss-Prot;Acc:Q9DDE3]
Human Orthologue:
ACHE
Human Description:
acetylcholinesterase [Source:HGNC Symbol;Acc:108]
Mouse Orthologue:
Ache
Mouse Description:
acetylcholinesterase Gene [Source:MGI Symbol;Acc:MGI:87876]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40891 Nonsense Mutation detected in F1 DNA During 2018
sa31572 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047951 Nonsense 35 215 2 3
ENSDART00000052989 Nonsense 35 634 2 5
Genomic Location (Zv9):
Chromosome 7 (position 27208621)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25811560
GRCz11 7 26082753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATAACTGTTTCGCACAGGCTGAACCTGACCTCGTAGTAGCAACAAGAT[T/A]GGGCAGAGTGCAGGGTACAAGATTGCCTGTTCCAGACCGGAGTCATGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047951 Nonsense 108 215 2 3
ENSDART00000052989 Nonsense 108 634 2 5
Genomic Location (Zv9):
Chromosome 7 (position 27208401)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25811340
GRCz11 7 26082533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCAGTTTGTGGATACCTCTTACCCGGGCTTTCCAGGTATTGAAATGTG[G/A]AACCCCAACAGAGTGATGAGTGAAGACTGTCTTTATCTGAATGTGTGGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link