zgc:92066

Ensembl ID:
ENSDARG00000031776
ZFIN ID:
ZDB-GENE-040718-72
Description:
ferritin heavy chain [Source:RefSeq peptide;Acc:NP_001002378]
Human Orthologue:
FTL
Human Description:
ferritin, light polypeptide [Source:HGNC Symbol;Acc:3999]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33211 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044238 Essential Splice Site 125 174 None 4
ENSDART00000109791 Essential Splice Site 177 226 None 5

The following transcripts of ENSDARG00000031776 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 32237521)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31968831
GRCz11 3 32100545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCTGCTGGACCTGCATAAAGTCGCCTCTCAAAAGGGAGACCCTCATG[T/C]AAGTTAATAAAGTCCATAATATACATTGGTCCTTAATACTTTAATTAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link