zgc:114060

Ensembl ID:
ENSDARG00000031775
ZFIN ID:
ZDB-GENE-050913-92
Description:
Ubiquitin-conjugating enzyme E2 S [Source:UniProtKB/Swiss-Prot;Acc:Q4V908]
Human Orthologue:
UBE2S
Human Description:
ubiquitin-conjugating enzyme E2S [Source:HGNC Symbol;Acc:17895]
Mouse Orthologue:
Ube2s
Mouse Description:
ubiquitin-conjugating enzyme E2S Gene [Source:MGI Symbol;Acc:MGI:1925141]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14888 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047452 Nonsense 216 221 4 4
Genomic Location (Zv9):
Chromosome 16 (position 15425983)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13784442
GRCz11 16 13674562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATATTAGCAAKACTAATATAGTCGCAAAGAAAAAAACAGATAAGAAA[C/T]GAGCTCTGAGGCGGCTATAAAAGATCTGTGCTTTTCTGTGTATATATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link