
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:114060
- Ensembl ID:
- ENSDARG00000031775
- ZFIN ID:
- ZDB-GENE-050913-92
- Description:
- Ubiquitin-conjugating enzyme E2 S [Source:UniProtKB/Swiss-Prot;Acc:Q4V908]
- Human Orthologue:
- UBE2S
- Human Description:
- ubiquitin-conjugating enzyme E2S [Source:HGNC Symbol;Acc:17895]
- Mouse Orthologue:
- Ube2s
- Mouse Description:
- ubiquitin-conjugating enzyme E2S Gene [Source:MGI Symbol;Acc:MGI:1925141]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14888 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14888
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047452 | Nonsense | 216 | 221 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 16 (position 15425983)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 13784442 GRCz11 16 13674562 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCAATATTAGCAAKACTAATATAGTCGCAAAGAAAAAAACAGATAAGAAA[C/T]GAGCTCTGAGGCGGCTATAAAAGATCTGTGCTTTTCTGTGTATATATAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: