smad6b

Ensembl ID:
ENSDARG00000031763
ZFIN ID:
ZDB-GENE-050419-198
Description:
hypothetical protein LOC564395 [Source:RefSeq peptide;Acc:NP_001038516]
Human Orthologue:
SMAD6
Human Description:
SMAD family member 6 [Source:HGNC Symbol;Acc:6772]
Mouse Orthologue:
Smad6
Mouse Description:
MAD homolog 6 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1336883]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10756 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100569 Nonsense 347 486 4 4
Genomic Location (Zv9):
Chromosome 18 (position 19479352)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19709575
GRCz11 18 19698641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGTGGGCCGCCTCTATACGGTGTACCAGCCTGCCGTCAGCATTTTCTA[T/A]GACCTACCTCAAGGTACGGGCTTCTGCCTTGGCCAGCTGAGCCTGGACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link