dab2

Ensembl ID:
ENSDARG00000031761
ZFIN ID:
ZDB-GENE-040303-1
Description:
disabled homolog 2 [Source:RefSeq peptide;Acc:NP_991320]
Human Orthologue:
DAB2
Human Description:
disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) [Source:HGNC Symbol;Acc:2662]
Mouse Orthologue:
Dab2
Mouse Description:
disabled homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109175]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45210 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017956   None 589 None 14
ENSDART00000031120 Essential Splice Site 116 134 None 9
ENSDART00000047670   None 589 None 14
ENSDART00000083862 Missense 177 574 6 8
ENSDART00000139732   None 589 None 15
Genomic Location (Zv9):
Chromosome 5 (position 33968509)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31730741
GRCz11 5 32330894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACTCTGAGTTCAGATCCCTTCAGCGACGATCCCTTTTCTCCCTTGAA[T/A]GATCAATCAGATTCTGTGTTTTCCTCCAATAACGAGTCAGATTTTTCTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link