
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
clstn1
- Ensembl ID:
- ENSDARG00000031720
- ZFIN ID:
- ZDB-GENE-040426-1064
- Description:
- calsyntenin 1 [Source:RefSeq peptide;Acc:NP_001071252]
- Human Orthologue:
- CLSTN1
- Human Description:
- calsyntenin 1 [Source:HGNC Symbol;Acc:17447]
- Mouse Orthologue:
- Clstn1
- Mouse Description:
- calsyntenin 1 Gene [Source:MGI Symbol;Acc:MGI:1929895]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16000 | Essential Splice Site | Available for shipment | Available now |
sa14307 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16000
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049985 | Essential Splice Site | 28 | 317 | None | 10 |
ENSDART00000059339 | Essential Splice Site | 28 | 964 | None | 18 |
ENSDART00000129248 | Essential Splice Site | 28 | 971 | None | 18 |
ENSDART00000130780 | Essential Splice Site | 28 | 317 | None | 13 |
ENSDART00000133902 | Essential Splice Site | 28 | 954 | None | 17 |
- Genomic Location (Zv9):
- Chromosome 23 (position 29910353)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 29740920 GRCz11 23 29667461 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAGTCGGTCTGCTTTTAGGACTATTATACGCGGTGGAKKCAGCCAAAGG[T/A]AAGATTTAAGAGCGTTTTGATCCATTGCCAGTGACAARATGTGAATATAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14307
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049985 | Nonsense | 176 | 317 | 5 | 10 |
ENSDART00000059339 | Nonsense | 176 | 964 | 5 | 18 |
ENSDART00000129248 | Nonsense | 166 | 971 | 4 | 18 |
ENSDART00000130780 | Nonsense | 176 | 317 | 5 | 13 |
ENSDART00000133902 | Nonsense | 166 | 954 | 4 | 17 |
- Genomic Location (Zv9):
- Chromosome 23 (position 29855541)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 29686108 GRCz11 23 29612649 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGTTCAAAGAGAAGTCCTACAAAGCCACAGTAATCGAGGGCAAGAAGTA[C/A]GACAGCATCATGAAGGTGGAGGCCGTGGAYGCAGACTGCTCTTTCCAGTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: